Transcription/Translation: Consider the gene below:
3′ 123456789101112131415161718192021 5′
TACCCTTAACCAATGAGTATT
5′
ATGGGAATTGGTTACTCATAA 3′
1.In the space below, write the nucleotide sequence for the mRNA encoded by the gene. Be sure to indicate the 3′ and 5′ ends for the mRNA.
2.Circle the translation start codon in the mRNA above.
3.What is the nucleotide sequence in the anti-codon loop of tRNA that is complementary to the start codon? ______. Indicate the 3′ and 5′ side of the anti-codon region.
4.What amino acid does the start codon specify? ________
5.Circle the translation stop codon in the mRNA strand above.
6.Using a codon table (see table in your text), in the space below write the predicted sequence of amino acids for the polypeptide encoded by this gene.
"Is this question part of your assignment? We Can Help!"
Other samples, services and questions:
When you use PaperHelp, you save one valuable — TIME
You can spend it for more important things than paper writing.
